¿Cuál es la diferencia entre mapeo de genes y secuenciación de genes?


Respuesta 1:

MAPEO DE GENES

El mapeo de genes se refiere al proceso de localizar genes en una cadena de ADN.

Una cadena de ADN es un largo tramo de secuencias de nucleótidos. Las regiones cortas selectivas de estos tramos largos de nucleótidos forman genes y son responsables de la formación de proteínas funcionales y estructurales.

Una sola cadena de ADN generalmente tiene múltiples genes, que pueden funcionar juntos o independientemente para formar proteínas que se expresan fenotípicamente. Cuando se estudia un ADN para descubrir el locus de diferentes genes en él, y la distancia respectiva entre ellos, el proceso se denomina mapeo de genes.

El primer mapa genético fue creado por Alfred Strutevant mientras trabajaba en Drosophila melanogaster con Thomas Hunt Morgan. Centimorgan se usó como una unidad para definir la distancia entre dos genes en un locus.

SECUENCIA GENÉTICA

La secuenciación de genes o la secuenciación de ADN se refiere a determinar el orden de los nucleótidos, es decir, para descubrir cómo se organizan las cuatro bases nitrogenadas A, T, G, C de modo que se pueda predecir la proteína resultante.

El primer organismo cuyo genoma fue completamente secuenciado fue el del bacteriófago phi × 174. Desde entonces, se han secuenciado varios organismos que incluyen E. coli, Drosophila melanogaster y Saccharomyces cerevisiae.

Para este propósito, se emplean varios métodos, como la secuenciación de Sanger y la secuenciación de alto rendimiento (HTS).

Espero que esto ayude.


Respuesta 2:

El mapeo es el proceso de localizar un gen dentro de algún contexto. Hay muchos tipos de mapas útiles, y también hay muchos tipos que ahora son puramente de interés histórico.

Un mapa citogenético le dice dónde está un gen en la estructura en bandas de un cromosoma metafásico. Entonces, por ejemplo, si un paciente tiene una eliminación de varias bandas del cromosoma 2, entonces el mapa citogenético sugerirá qué genes se han perdido y puede ser responsable de cualquier fenotipo.

Un mapa genético o recombinacional o de enlace tiene las distancias entre los genes en términos de la frecuencia con la que se heredan conjuntamente. Es un ejercicio fácil en el aula en Drosophila medir las frecuencias recombinacionales entre los marcadores y construir un mapa de enlace simple.

Un mapa físico es un mapa a lo largo del ADN de algún tipo de característica física. El tipo más común en estos días es un mapa óptico, que utiliza microscopía de alta potencia de moléculas de ADN individuales para medir la distancia entre puntos de referencia de secuencia corta en la molécula. Los mapas ópticos son útiles porque brindan información de muy largo alcance que es útil para la secuenciación (ver más abajo).

Un mapa de haplotipos muestra qué alelos están contenidos en la misma cadena de ADN.

La secuencia es determinar la secuencia real de A, C, G y T del ADN. Las plataformas de secuenciación múltiple son de uso común: Illumina, Pacific Biosciences, Oxford Nanopore e Ion Torrent son quizás las más utilizadas. Cada uno funciona determinando la secuencia de fragmentos de ADN, con cada tipo de instrumento que tiene longitudes características de fragmentos que pueden secuenciar, tasas de error y modos y el número de fragmentos que pueden secuenciarse. Por ejemplo, los instrumentos Illumina e Ion Torrent secuencian enormes cantidades de fragmentos de unos cientos de pares de bases con una precisión muy alta, mientras que Pacific Biosciences y Oxford Nanopore fragmentan secuencias que pueden tener decenas de miles de bases de largo (o incluso cientos o más de un millón para Oxford Nanopore), pero muchos menos que Illumina y con tasas de error bruto mucho más altas.

Potentes algoritmos informáticos combinan los fragmentos aleatorios de información de secuencia, al encontrar subsecuencias comunes, para crear secuencias contiguas largas llamadas contigs. Desafortunadamente, algunas regiones de genomas eucariotas (la mayoría de los genomas bacterianos y arqueológicos pueden secuenciarse casi a la perfección) no pueden resolverse porque son duplicados (o muy cercanos a ser duplicados) de otras regiones del genoma. Si tales repeticiones son más largas que la longitud de lectura, entonces no pueden resolverse. En realidad, hay un brazo completo de un cromosoma que no se puede resolver debido a esto. Aquí es donde los mapas ópticos realmente agregan valor: puede unir los contigs en andamios utilizando mapas ópticos (y otras técnicas), ordenando los contigs y estimando (pero sin obtener la secuencia exacta) los espacios entre ellos.

En última instancia, el objetivo es que todos estos mapas estén unidos. Si usa una sonda de secuencia conocida para mapear un gen a una banda cromosómica, habrá creado un enlace entre el mapa citogenético y la secuencia. De manera similar, al mapear marcadores genéticos de secuencia conocida, se crean enlaces entre el mapa de enlace y la secuencia. Este fue un subesfuerzo importante y a menudo poco apreciado del Proyecto Genoma Humano y proyectos posteriores: para garantizar que todos los tipos de mapas estuvieran interconectados. Esto tenía un valor científico directo: es interesante cuando las distancias de un mapa no están correlacionadas linealmente con las distancias de otros mapas, el valor científico aplicado al permitir la integración de diferentes tipos de estudios y también sirvió como una verificación cruzada importante en el mapa unificado final.

Nos acercamos rápidamente a una era en la que los andamios a escala cromosómica se pueden generar de forma rutinaria para prácticamente cualquier eucariota. La variación genética de unos pocos individuos se puede utilizar para generar las herramientas para generar mapas de enlaces densos. Los mapas citogenéticos siguen siendo laboriosos para crear, pero en la mayoría de los organismos son más un lujo que una necesidad.


Respuesta 3:

El mapeo de genes se produjo antes de la secuenciación de genes. El mapeo de genes hace las siguientes suposiciones:

  1. De los experimentos con no disyunción, puedo aislar un cromosoma completo. Una vez que sé qué rasgos hay en un cromosoma, puedo comparar dos, tres o cuatro pares de alelos, como se describe a continuación. El carnicero con los ojos vendados y un análisis estadístico de cuchilla. Al observar los datos de recombinación en la generación F1 y F2, puedo determinar si el gen de cada padre es homocigoto dominante, heterocigoto u homocigoto recesivo. Una vez que lo he comprobado, comparo los resultados reales de la progenie con los esperados. Utilizando el análisis estadístico (principio / fórmula de hardy-weinberg) puedo calcular la distancia física entre alelos en un cromosoma. ¿Cómo puedo hacer eso? Bueno, en términos simples, cuanto más cerca están dos genes físicamente, menos posibilidades hay de que se crucen durante la meiosis. Otros métodos estadísticos (como el análisis de chi cuadrado) pueden darme una idea del nivel de certeza de que mi mapeo es correcto o por casualidad

La secuenciación de genes se ha hecho cargo del mapeo de genes, en su mayor parte:

  1. El ADN se prepara haciendo múltiples copias de él. Parte del proceso es calentarlo y enfriarlo. El ADN se corta en fragmentos aleatorios por fuerza mecánica. El orden preciso de los nucleótidos dentro de una molécula de ADN es reconstruido por computadoras. Si bien las computadoras no determinan el nombre del gen, lo hacen secuencia en el nivel de ácido nucleico (C, G, T, A). Cual es el truco Estadísticamente, una computadora (las estaciones de trabajo de PC multinúcleo de hoy pueden hacer el trabajo fácilmente) puede resolver un final. ¿Cómo se determina un final? Imagine un conjunto de fragmentos que todos comenzaron así: GGGGGGCCTGGGGGGCCTAGGGGGGCCTACGCTTCGGGGGGCCTACGCTTCAAA Cuando se compara con todos los otros fragmentos, habrá dos ocurrencias de dichos patrones, uno para cada extremo. Una vez que la computadora calcula estadísticamente los dos extremos del ADN, todos los puntos intermedios se juntan.

NOTA: Mirando hacia atrás en el proyecto del genoma humano, se sospecha que .5% a 1% del genoma humano puede no ser humano, pero es un código de otras especies que pueden haber sido mezcladas con ADN humano. Si alguien tiene alguna referencia a esto, hágamelo saber, ya que estoy interesado en leer más al respecto.